PROBES AND PRIMER SEQUENCES SPECIFIC TO Clostridium perfringnes ENTEROTOXIN
The figure below shows a schematic diagram of the relative locations of some hybridization probes and PCR primer sets specific to the C. perfringens enterotoxin gene. Information about each probe or primer set is given below. This list is not intended to be comprehensive, but to serve as a starting point.
The sequence of the C. perfringens enterotoxin gene can be found at GenBank accession M98037.
Hybridization Probes
| Probe # | Sequence | Reference |
| CPT03 | atgcttagtaacaatttaaatccaatggtgttcgaaaatg | |
| CPT07 | tatatgatgaattagctttcattacaagaacatattgtcc | |
| CPT08 | tgcattaaactcaaacccagctggaaatttatatgattgg | |
| CPT11 | tgtagaatatggatttggaataactataggagaacaaaat |
PCR Primers
| Primer Pair # | Primer A (5'-3') | Primer B (5'-3') | Reference |
| atgtaatagataaaggagatggtt | ataaattcagaagtaaatccaact | ||
| caaatgaatatgtatattataa | atatttcctaagctatctgcag | ||
| tgtagaatatggatttggaat | agctggatttgagtttaatg | ||
| tgttaatactttaaggatatgtatcc | tccatcacctaaggactg |
References
1. Van Damme-Jongsten, M., J. Rodhouse, R. Gilbert, and S. Notermans. 1990. Synthetic DNA Probes for Detection of Enterotoxigenic Clostridium perfringens Strains Isolated from Outbreaks of Food Poisoning. J. Clin. Microbiol. 28; 131-135.
2. Daube, G., B. China, P. Simon, K. Hvala, and J. Mainil. 1994. Typing of Clostridium perfringens by in vitro Amplification of Toxin Genes. J. Appl. Bacteriol. 77; 650-655.
3. Baez, L and V. Juneja. 1995. Detection of Enterotoxigenic Clostridium perfringens in Raw Beef by Polymerase Chain Reaction. J. Food Protect. 58; 154-159.
4. Saito, M., M. Matsumoto, and M. Funabashi. 1992. Detection of Clostridium perfringens enterotoxin Gene by the Polymerase Chain Reaction Amplification Procedure. Int. J. Food Microbiol. 17; 47-55.
5. Kokai-Kun, J., J. Songer, J. Czeczulin, F. Chen, and B. McClane. 1994. Comparison of Western Immunoblots and Gene Detection Assays for Identification of Potenially Enterotoxigenic Isolates of Clostridium perfringens. J. Clinical Microbiol. 32; 2533-2539.
Return to Clostridium page.